rs10954247 chr7:129606609 T>C
- Sequence
ccgaggcaggtggatcacctgagg[T/C]caggagtttgagaccagcctggct
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.55 | -0.21 | 1.96 | |||
| K562 (myelogenous leukemia) | 0.07 | 0.52 | 1.51 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid