rs10960809 chr9:12816002 C>T
- Sequence
cagctacatcttttgctggagtta[C/T]tgagcagcagaattgattcttctg
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -1.62 | 1.41 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, alzheimers disease, arthritis including non-rheumatoid, bipolar disorder in alcoholics, crohns disease, combined control dataset, homa-b, irritible bowel syndrome, ldl cholesterol, schizophrenia, spine bone mineral density (bmd), stabilized warfarin dose, tardive dyskinesia