rs10982134 chr9:114288718 G>A
- Sequence
tcattcagggccctgtgggtgatc[G/A]aggagaccgcggggaaccgggaga
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.01 | 1.76 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, schizophrenia, stabilized warfarin dose, total cholesterol