rs11007543 chr10:29377739 G>A
- Sequence
gaactccaagattctagtgcaccc[G/A]aatagtgtacattgtacctgatgt
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.76 | -1.28 | 1.56 | |||
| A549 (lung carcinoma) | -0.22 | 0.58 | 2.00 |
Items per page:
1 – 2 of 2