rs11022735 chr11:13271180 A>C
- Sequence
agctatgggagatatagaagtgaa[A/C]tatgcaggtgtggcacctgcctca
- ASB in cell types
- CWR22 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CWR22 (prostate carcinoma) | -0.46 | 1.01 | 1.50 |
Items per page:
1 – 1 of 1