rs11024074 chr11:16895672 T>C
- Sequence
agggcaccaaggaacaatctgcca[T/C]tgcagggaaaaaagcaaattgtat
- ASB in cell types
- PC3 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.65 | 1.68 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, albumin/globulin ratio, aortic valve calcium, breast cancer, coronary artery disease (cad), diastolic blood pressure (dbp), hdl cholesterol, hypertension, lymphocyte count, major depressive disorder, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (broad definition) (males), neuroblastoma (brain cancer), neuroticism, serum creatinine, systolic blood pressure (sbp)
PheWAS acid-base balance disorder, acidosis, acquired absence of breast, acute pharyngitis, acute sinusitis, adrenal hyperfunction, allergic reaction to food, altered mental status, anomalies of tooth position/malocclusion, aplastic anemia, benign neoplasm of thyroid glands, bipolar, choroidal degenerations, chronic venous insufficiency, congenital anomalies of the eye, conjunctivitis, infectious, corneal degenerations, cyst and pseudocyst of pancreas, degeneration of intervertebral disc, dentofacial anomalies, including malocclusion, disease of capillaries, diseases of the tongue, disorders of conjunctiva, disorders of cornea, disorders of esophageal motility, dupuytrens disease, elevated sedimentation rate, essential tremor, fracture of foot, gestational diabetes, hereditary and idiopathic peripheral neuropathy, hereditary hemolytic anemias, hypertension complicating pregnancy, hypocalcemia, hypoventilation, intestinal infection due to c. difficile, jaundice, kidney replaced by transpant, known or suspected fetal abnormality, liver replaced by transplant, meningitis, methicillin sensitive staphylococcus aureus, muscular dystrophies and other myopathies, myeloid leukemia, nerve plexus lesions, neuralgia, neuritis, and radiculitis nos, nonallopathic lesions nec, open wound of finger(s), osteitis deformans and osteopathies associated with other disorders, osteochondropathies, otalgia, other disorders of biliary tract, other hereditary hemolytic anemias, palpitations, peripheral angiopathy in diseases classified elsewhere, pilonidal cyst, pneumococcal pneumonia, poisoning by anticonvulsants and anti-parkinsonism drugs, postlaminectomy syndrome, posttraumatic stress disorder, primary open angle glaucoma, pruritus and related conditions, pseudomonal pneumonia, pulmonary congestion and hypostasis, renal colic, rhabdomyolysis, scar conditions and fibrosis of skin, secondary malignancy of brain/spine, secondary malignant neoplasm of liver, traumatic arthropathy, ulcer of esophagus, unspecified erythematous condition, urinary complications
GTEx eQTL Esophagus_Mucosa, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood