rs11030665 chr11:29334385 G>T
- Sequence
ctgaaggctgtgtgtgctgaggtt[G/T]aacattaacttatactgccatcat
- ASB in cell types
- A549 (lung carcinoma) VCaP (prostate carcinoma) GM12878 (female B-cells) spleen
- ASB for transcription factors
- SMC3_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -0.26 | 1.19 | 1.99 | n/a | n/a | |||
| RAD21_HUMAN | 0.25 | 1.22 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, bipolar disorder in alcoholics, body mass index (bmi), ldl cholesterol change with statins, mitral annular calcium, obesity with early age of onset (age >2), total cholesterol change with statins, triglycerides