rs11036634 chr11:5287498 C>T
- Sequence
agatgaagaaactgagtcatacaa[C/T]tactaagagaaactgagtcactaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NCOR1_HUMAN | 1.90 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, beta-thalassemia/hemoglobin e disease (absolute fetal hemoglobin (hb), g/dl), beta-thalassemia/hemoglobin e disease (fetal hemoglobin (hb), %), beta-thalassemia/hemoglobin e disease (severity), decrease in fev1 (in nonasthmatic participants >=30 years old), microalbuminuria, tetrology of fallot