rs11048456 chr12:26310149 C>T
- Sequence
tctacacattttaggatgatttta[C/T]cagcatgaatgataataaaggtta
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.32 | 0.29 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI high density lipoprotein cholesterol levels, lipid traits (pleiotropy) (hipo component 1), reticulocyte count, type 2 diabetes
GRASP adiponectin levels, advanced age-related macular degeneration, diastolic blood pressure (dbp), fasting insulin, hdl cholesterol, homa-b, homa-ir, rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol, triglycerides, urinary albumin-to-creatinine ratio, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg