rs11060331 chr12:129413574 T>G
- Sequence
ttttctcaccctagagaaatatag[T/G]tgatattggagagaattagataca
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ATF7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | n/a | 3.50 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, asthma, chronic kidney disease, hdl cholesterol, obesity with early age of onset (age >2), tetrology of fallot, triglycerides