rs11061340 chr12:131132764 T>C
- Sequence
catatgaccgtgtgactgttcagt[T/C]agcacccccaaaccacagggctga
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.77 | -0.27 | 2.02 | |||
| K562 (myelogenous leukemia) | 0.67 | -0.23 | 2.03 | |||
| 22RV1 (prostate carcinoma) | 1.78 | -0.11 | 2.00 |
Items per page:
1 – 3 of 3