rs11065215 chr12:120692543 A>C
- Sequence
tcgtggctaatgtcacttacagga[A/C]ctgttaacagttatgtttattttt
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- SOX13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SOX13_HUMAN | 1.65 | -1.97 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid