rs11067547 chr12:115354344 A>G
- Sequence
tgaaagtaaaatccacactccgcc[A/G]aacggcactgaggctgcattccca
- ASB in cell types
- LHSAR (prostate epithelial cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 1.72 | n/a | 1.50 | |||
| HEK293 (embryonic kidney) | -0.12 | 0.78 | 2.02 |
Items per page:
1 – 2 of 2