rs1107081 chr1:23528396 G>A
- Sequence
gggtttggagctgttccaggtcac[G/A]cccttgtaaaatgagtaagcagag
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.11 | -1.14 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), infant head circumference, triglycerides change with statins, waist hip ratio