rs11077796 chr17:75783489 A>T
- Sequence
ttaaagcaatatactacaactttt[A/T]tttgtccttttgtaatttttcatt
- ASB in cell types
- breast tumor tissue epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor tissue | 1.38 | n/a | 2.50 | |||
| epidermal keratinocytes | 1.47 | -1.36 | 2.00 |
Items per page:
1 – 2 of 2