rs11079682 chr17:67104822 A>T
- Sequence
atcatcagtaaatagggaaatgca[A/T]atcaaaactacagtgagggctggg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.63 | 0.07 | 1.72 | |||
| periferal blood macrophages | 1.54 | 2.16 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas, Pituitary, Spleen, Stomach