rs11097730 chr4:77194181 C>T
- Sequence
gctaacttactgaagttacgtaaa[C/T]tccaagagaaatacacgggtttag
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.57 | 0.56 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, diastolic blood pressure (dbp), hypertension (early onset hypertension), resistance to kuru in aged women despite likely exposure, transmission distortion, triglycerides change with statins
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Muscle_Skeletal