rs11099112 chr4:131645013 G>A
- Sequence
tggatcttatctgcttctgtgttg[G/A]ttccatatttttcctgtactccac
- ASB in cell types
- foreskin keratinocyte LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.32 | 2.14 | 2.50 | |||
| LNCaP (prostate carcinoma) | -0.37 | 1.65 | 1.75 |
Items per page:
1 – 2 of 2