rs111067838 chr16:88380821 C>T
- Sequence
cacacatgcacacacacccagaca[C/T]acacacacacgcactcacacagac
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.16 | -0.27 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -1.69 | 1.89 | 1.50 | |||
| HEK293 (embryonic kidney) | 0.30 | 0.41 | 1.75 |
Items per page:
1 – 3 of 3