rs111168 chr6:16306128 C>G
- Sequence
tcctgctgtgcccttcctcccgcc[C/G]gctcactgacagacactcgtggaa
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.54 | -1.43 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, hdl cholesterol, obesity with early age of onset (age >2), parkinsons disease, triglycerides