rs11119894 chr1:206951585 G>T
- Sequence
tgagtcaatgtttaacccctgact[G/T]gagtcaatgtttaatcccaggcca
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.06 | 0.72 | 1.29 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Heart_Atrial_Appendage, Nerve_Tibial, Thyroid