rs11123183 chr2:113387743 C>T
- Sequence
aacatgtgctcattcatcgtagtt[C/T]gttgctcgtgccacgtggtcattg
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.98 | -1.98 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, mitral annular calcium, obesity with early age of onset (age >2), parkinsons disease, suicide attempts in bipolar disorder (substance abuse/dependence)
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid