rs11123513 chr2:119290974 A>T
- Sequence
acgccaaggctgacttacaggggg[A/T]caaacctattgaacacagtcctta
- ASB in cell types
- A549 (lung carcinoma) epithelial cell of prostate gastroesophageal sphincter upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN SMC3_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.66 | 0.08 | 1.43 | n/a | No Hit | |||
| SMC3_HUMAN | 1.64 | -0.98 | 2.00 | n/a | n/a | |||
| RAD21_HUMAN | 1.61 | -0.53 | 2.03 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis