rs11135740 chr8:23510244 G>A
- Sequence
tctccttttactcccagacttcaa[G/A]actctttttcacgtacccattttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.29 | 0.58 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, barnes akathisia rating scale, body mass index (bmi), diastolic blood pressure (dbp), height, hypertension (early onset hypertension), ldl cholesterol, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid