rs111459942 chr5:35926474 C>T
- Sequence
caactgccacgccaaactctctcc[C/T]gcctggattttgcgaattattgta
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.19 | n/a | 2.17 | |||
| HEK293 (embryonic kidney) | -0.63 | 0.59 | 2.75 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.17 | -0.61 | 1.17 |
Items per page:
1 – 3 of 3