rs11153279 chr6:111266063 T>C
- Sequence
tcctgcactcaaccaatcatctga[T/C]gctgactcagaagctctgtttgga
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN ZN316_HUMAN EMSY_HUMAN SOX6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -2.16 | 2.36 | 2.00 | n/a | No Hit | |||
| ZN316_HUMAN | 2.67 | -0.06 | 2.00 | n/a | n/a | |||
| EMSY_HUMAN | 2.65 | n/a | 2.00 | n/a | n/a | |||
| SOX6_HUMAN | 2.31 | -3.35 | 2.00 | n/a | n/a | |||
| NFE2_HUMAN | 1.44 | -1.13 | 1.75 | 1.03 | Weak Discordant |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GRASP chronic kidney disease, irritible bowel syndrome, refractive error, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood