rs11154801 chr6:135418217 C>A
- Sequence
ttctgggaatacagacactggccc[C/A]acttgaggtttcgaccttctgaag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 0.69 | 1.81 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, cystatin c in serum, hip bone mineral density (bmd), multiple sclerosis, refractive error, schizophrenia, sporadic creutzfeldt-jakob disease, triglycerides
PheWAS acute cystitis, adrenal hypofunction, adverse effects of antirheumatics, apnea, arthropathy associated with infections, cancer of oropharynx, cerebrovascular disease, cervical cancer, cervicocranial/cervicobrachial syndrome, chronic rheumatic disease of the heart valves, concussion, congenital anomalies of peripheral vascular system, congenital musculoskeletal deformities of spine, cysts of the jaws, degeneration of intervertebral disc, disorders resulting from impaired renal function, diverticulitis, diverticulosis, diverticulosis and diverticulitis, dystrophy of female genital tract, dysuria, elevated blood pressure reading, failure to thrive, fracture of foot, ill-defined descriptions and complications of heart disease, impaction of intestine, incisional hernia, infertility, female, inflammatory bowel disease, intervertebral disc disorders, ischemic stroke, joint effusions, lipoid metabolism disorder nos, malignant neoplasm of kidney and other urinary organs, malignant neoplasm of renal pelvis, mastodynia, mental retardation, morbid obesity, myoclonus, noninflammatory disorders of ovary, fallopian tube, & broad ligament, nonrheumatic tricuspid valve disorders, occlusion of cerebral arteries, open wound of lip and mouth, open wounds of head, neck, and trunk, other pulmonary inflamation or edema, otitis media, otorrhea, overweight, pernicious or b12 deficiency anemia, postinflammatory pulmonary fibrosis, primary pulmonary hypertension, retinal edema and hypertensive retinopathy, secondary hyperparathyroidism (of renal origin), spirochetal infection, stricture/obstruction of ureter, subarachnoid hemorrhage (injury), suppurative and unspecified otitis media, symptoms involving female genital tract, symptoms of the muscles, toxic effect of venom, type 1 diabetes nephropathy, type 1 diabetic neuropathy, ulcerative colitis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood