rs11158109 chr14:56474646 G>A
- Sequence
tttgaccaaagttaatactgcaga[G/A]ataaaagctacattccgtagaaat
- ASB in cell types
- foreskin keratinocyte B-cells epidermal keratinocytes
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.75 | 0.57 | 1.31 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, chronic kidney disease, major depressive disorder, serum creatinine