rs11160206 chr14:94689719 T>C
- Sequence
cacagcccgggcctctcggcaggc[T/C]tggggctgcgagaggggccgcgga
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.27 | 1.08 | 1.95 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.81 | 0.13 | 1.53 | |||
| GM12878 (female B-cells) | 0.86 | 0.10 | 1.33 | |||
| VCaP (prostate carcinoma) | -0.48 | 0.70 | 2.00 |
Items per page:
1 – 4 of 4