rs11166315 chr1:99737287 C>G
- Sequence
agaatcggcttaaaataaatgctg[C/G]cttctgctgatttgacaaaggagc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte OVCAR8 (high grade ovarian serous adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.76 | -0.46 | 1.99 | |||
| foreskin keratinocyte | 2.20 | -0.30 | 2.67 | |||
| OVCAR8 (high grade ovarian serous adenocarcinoma) | -2.17 | 1.88 | 1.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood