rs11168284 chr12:47889266 A>G
- Sequence
gcctggccgagtccagtaccccca[A/G]tcgcctgcctgagcagcttcaggg
- ASB in cell types
- periferal blood macrophages monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | -0.18 | 1.97 | 2.00 | |||
| monocyte-derived macrophages | 1.95 | -0.09 | 2.50 |
Items per page:
1 – 2 of 2