rs11175184 chr12:63848215 A>G
- Sequence
agatggggtttcgacatgttggcc[A/G]ggctggtctcgaactcctgacctc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.26 | 0.39 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Ovary, Prostate, Skin_Sun_Exposed_Lower_leg, Thyroid