rs111769 chr17:46794621 C>T
- Sequence
attcagcaccttaacccattctca[C/T]accagtcaaactttcgacagtcct
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.57 | -0.10 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP mitral annular calcium, parkinsons disease, serum creatinine, systolic blood pressure (sbp), triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Liver, Muscle_Skeletal, Nerve_Tibial, Prostate, Thyroid, Whole_Blood