rs11188601 chr10:96097142 T>C
- Sequence
cacatattggttctttagaaatca[T/C]ttccctcctcctttagaaatcact
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.79 | 1.37 | 2.08 | 2.76 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cortex, Cells_Cultured_fibroblasts, Nerve_Tibial, Testis, Thyroid