rs111934993 chr1:157074434 A>G
- Sequence
cgagatcgccacctacaggaagct[A/G]ctggagggcgaggagagccggctg
- ASB in cell types
- heart left ventricle 786-O (renal carcinoma) GM10266 (male B-cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.16 | -0.14 | 1.19 | -0.80 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
