rs112020113 chr1:236282075 G>A
- Sequence
cttgtgggagttgtggtcctgggc[G/A]gtcgcctaggcgccgcggcaggaa
- ASB in cell types
- K562 (myelogenous leukemia) monocyte-derived macrophages breast tumor tissue
- ASB for transcription factors
- NRF1_HUMAN VEZF1_HUMAN TF65_HUMAN MEIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | n/a | 2.82 | 2.50 | 1.92 | Weak Concordant | |||
| VEZF1_HUMAN | n/a | 2.96 | 2.50 | n/a | No Hit | |||
| TF65_HUMAN | 2.10 | n/a | 2.50 | n/a | No Hit | |||
| MEIS2_HUMAN | -3.95 | 2.18 | 2.50 | n/a | No Hit | |||
| ESR1_HUMAN | 1.11 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid