rs11203190 chr21:41865404 T>C
- Sequence
caacggccaagagggcaaggcttg[T/C]ggcagccttgcacagtgggatata
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.70 | 0.57 | 1.28 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), docetaxel response in lymphoblastoid cell lines, paclitaxel-induced cytotoxicity in lymphoblastoid cell lines, parkinsons disease
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial