rs11210772 chr1:42982828 A>G
- Sequence
atctcctctgcaacattgctggca[A/G]gtgctgatactgcctctgcaacaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MTG16_HUMAN ARI1B_HUMAN HTF4_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG16_HUMAN | n/a | 2.78 | 1.33 | n/a | n/a | |||
| ARI1B_HUMAN | n/a | 2.06 | 1.00 | n/a | n/a | |||
| HTF4_HUMAN | -3.32 | 2.93 | 1.33 | n/a | No Hit | |||
| NCOR1_HUMAN | 0.16 | 2.04 | 1.33 | n/a | n/a | |||
| TAL1_HUMAN | -0.96 | 2.03 | 1.42 | 0.66 | Weak Concordant |
Items per page:
1 – 5 of 10
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid