rs11214259 chr11:112588388 A>G
- Sequence
gttaatcatgtagacgggtagcct[A/G]gagaagcgtggtccccgtggagca
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.77 | -0.21 | 2.00 | |||
| foreskin keratinocyte | 0.51 | n/a | 2.50 | |||
| erythroid cells | -1.68 | 1.74 | 2.00 |
Items per page:
1 – 3 of 3