rs11223627 chr11:133930874 G>A
- Sequence
cagggctgcactgacttaggaagg[G/A]agcccgcagagtgcagcggccacc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) adrenal gland LNCaP (prostate carcinoma) gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN PRDM9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.10 | 1.18 | 1.38 | -0.24 | Weak Discordant | |||
| PRDM9_HUMAN | -0.46 | 1.81 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
