rs11236460 chr11:75583878 G>A
- Sequence
actgggaagtggctgccgcaggga[G/A]gagctaggcctcgagtgaagcctg
- ASB in cell types
- HEK293 (embryonic kidney) neural cell MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- KLF1_HUMAN SMC3_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF1_HUMAN | n/a | 2.17 | 1.33 | -3.98 | Discordant | |||
| SMC3_HUMAN | 1.61 | -1.86 | 1.33 | n/a | n/a | |||
| CTCF_HUMAN | 1.36 | -1.42 | 1.17 | -3.49 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, cystatin c in serum
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid