rs11244262 chr9:131050535 T>G
- Sequence
cccagcactttgggaggctgaggt[T/G]gggggggatcttctgaggtcagga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | -0.70 | 4.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Spinal_cord_cervical_c-1, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood