rs1124911 chr15:82750492 T>C
- Sequence
agctcctcggcgcttccagtaatg[T/C]cacgctggtgcgtggggcgggact
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages GM12878 (female B-cells) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- SPI1_HUMAN FOXK2_HUMAN GATA1_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.34 | 0.87 | 2.06 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.57 | 0.42 | 1.67 | n/a | n/a | |||
| GATA1_HUMAN | 2.04 | n/a | 2.00 | n/a | No Hit | |||
| MNT_HUMAN | 0.29 | 1.20 | 1.67 | n/a | n/a | |||
| NRF1_HUMAN | 1.22 | 1.01 | 1.90 | 1.59 | Weak Discordant |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GRASP coronary artery disease (cad), hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood