rs11249215 chr1:24970693 G>A
- Sequence
gcaggtctgctgcagccacatccc[G/A]tcgtgtccccaggatacccctcca
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.30 | 0.56 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ankylosing spondylitis, ankylosing spondylitis (hla-b27 negative), ankylosing spondylitis (hla-b27 positive), height in type 2 diabetes cases, ldl cholesterol change with statins, microalbuminuria, prop taste detection threshold, total cholesterol, total cholesterol change with statins, triglycerides