rs11260823 chr1:16606350 T>G
- Sequence
tgaagcacagggaattttcagcag[T/G]gaaactctttcgcatgatgctgta
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.33 | -0.68 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.83 | -0.39 | 2.33 | |||
| HepG2 (hepatoblastoma) | 0.98 | -0.11 | 1.54 |
Items per page:
1 – 3 of 3