rs112794170 chr15:66818072 C>T
- Sequence
ttgaactcctgagctcaggtgatc[C/T]gcctacctgggcctcccaaaatgc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.34 | 0.48 | 1.34 | |||
| HEK293T (embryonic kidney) | 1.06 | 0.09 | 1.17 |
Items per page:
1 – 2 of 2