rs112895247 chr14:103075684 G>T
- Sequence
cgcccggctcctccgcccgcggcc[G/T]ccgagggacgtggtcgggcgttcc
- ASB in cell types
- HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | -0.35 | 1.23 | 1.33 |
Items per page:
1 – 1 of 1