rs113126385 chr2:46987163 C>A
- Sequence
tcggtgggtgggggtggagggcgt[C/A]tcttcccctcaccgccactagagg
- ASB in cell types
- neutrophils SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | 2.79 | -0.20 | 1.50 | |||
| SK-N-SH (neuroblastoma) | 0.70 | 1.30 | 1.50 |
Items per page:
1 – 2 of 2