rs113377631 chr3:196528902 G>A
- Sequence
ctccgcggggagctgggcggtggc[G/A]ggggccgcgggagtggagccggcc
- ASB in cell types
- pancreas MCF7 (Invasive ductal breast carcinoma) uterus thyroid gland
- ASB for transcription factors
- CTCF_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.15 | 0.52 | 1.41 | n/a | No Hit | |||
| SPI1_HUMAN | 0.93 | -0.58 | 2.10 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood