rs1134847 chr16:82170137 T>C
- Sequence
gcgtccccgcaccttcatgcgcag[T/C]agattcttggacaaccttgtcttt
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney) neural cell HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.22 | 0.61 | 1.98 | |||
| HEK293 (embryonic kidney) | 0.47 | 0.77 | 1.70 | |||
| neural cell | -0.14 | 0.76 | 1.20 | |||
| HEK293T (embryonic kidney) | 1.16 | -0.27 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood